Dendroboard banner

21 - 38 of 38 Posts

·
Registered
Joined
·
155 Posts
Discussion Starter #21
Yeah, the "flashmarks" is pretty subjective in my opinion. I haven't seen enough/good evidence on what it actually means lol. Even the mantella guide just shows a drawing -- no example individuals.

That said, the U-chin is a classical madagascariensis trait that isn't found in baroni. I'd say the fact that the offspring have it, is pretty indicative that they have at least some madagascariensis lineage.

There definitely are documented naturally occurring hybrid individuals.

There isn't a published genome for madagascariensis and baroni, right? If you have access to a PCR machine, this would actually be a pretty easy/cheap thing to validate in the lab lol.
I think you're gravely underestimating the ease and costs of DNA sequencing. Having a PCR machine in the lab (which we obviously do) does not help for sequencing on its own, you need a separate machine for that. There's also no need to sequence the whole genome, this is unnecessary as we can use some specific genes for species identification. Published data is available for these genes, so that would greatly help identification.

what do the undersides and irises look like?
These are two animals that were already picture in the opening post, but here is the previous shot with the belly and eye shots together:
 
  • Like
Reactions: hypostatic

·
Registered
Joined
·
2,469 Posts
I think you're gravely underestimating the ease and costs of DNA sequencing. Having a PCR machine in the lab (which we obviously do) does not help for sequencing on its own, you need a separate machine for that. There's also no need to sequence the whole genome, this is unnecessary as we can use some specific genes for species identification. Published data is available for these genes, so that would greatly help identification.
Well that's why I asked about whether reference genomes were available for the species. If they're published, you just need primers for stretches of DNA that are different for each species, and you can just do a regular genotyping PCR run. Sequencing wouldn't be necessary.

OH HEY, while the whole genome hasn't been published, it does look like there is some mtDNA data available:
https://www.ncbi.nlm.nih.gov/bioproject/?term=mantella

Here are specific primers based on that information:
Baroni
Madagascariensis

So yeah... you should be able to tell the species based on whether you get amplification or not, and by PCR band size...

Assuming you have access to everything else needed to run a PCR, the primers would only set you back about $40....
 

·
Registered
Joined
·
155 Posts
Discussion Starter #23
Well that's why I asked about whether reference genomes were available for the species. If they're published, you just need primers for stretches of DNA that are different for each species, and you can just do a regular genotyping PCR run. Sequencing wouldn't be necessary.

OH HEY, while the whole genome hasn't been published, it does look like there is some mtDNA data available:
https://www.ncbi.nlm.nih.gov/bioproject/?term=mantella

Here are specific primers based on that information:
Baroni
Madagascariensis

So yeah... you should be able to tell the species based on whether you get amplification or not, and by PCR band size...

Assuming you have access to everything else needed to run a PCR, the primers would only set you back about $40....
I honestly hadn't considered that :rolleyes:

I've worked with COI barcoding in the past and I'm now mostly doing metagenomics so this option completely slipped my mind.

I'll see if I can get this done somewhere in the next weeks, it might require some tweaking with cycle nr etc. and ideally I'll want a positive control for madagascariensis (but that's likely going to be difficult to get).
 
  • Like
Reactions: hypostatic

·
Registered
Joined
·
2,469 Posts
I'll see if I can get this done somewhere in the next weeks, it might require some tweaking with cycle nr etc. and ideally I'll want a positive control for madagascariensis (but that's likely going to be difficult to get).
haha, yeah, there's still lots of old school genetics that gets done ;)

The only real drawback for this approach is the fidelity of the available information. The paper is behind a paywall for me, so I'm not sure how rigorous their data collection methodology is. That said, the BLAST algorithm should prevent non species-specific primer binding. The primer design past is based on Primer3, which is also pretty accurate and trusted.

In this case a real positive control would be hard to get ahold of, due to the lack of information. But a well-designed assay would go a long way. You could start with just one individual to test things out, and run the baroni/madagascariensis primer sets in different tubes to avoid potential complications. And then as long as you only really get an amplicon of the expected size, you should be good.

OH and I guess the other thing you'd need is some sort of kit for amplifying genomic DNA from swabs or other similar method.

But yeah, this would be a nice thing for us to have in the hobby, to confirm/prove the identities of baroni/madagascariensis. Other methods are completely subjective...
 

·
Registered
Joined
·
155 Posts
Discussion Starter #25
haha, yeah, there's still lots of old school genetics that gets done ;)

The only real drawback for this approach is the fidelity of the available information. The paper is behind a paywall for me, so I'm not sure how rigorous their data collection methodology is. That said, the BLAST algorithm should prevent non species-specific primer binding. The primer design past is based on Primer3, which is also pretty accurate and trusted.

In this case a real positive control would be hard to get ahold of, due to the lack of information. But a well-designed assay would go a long way. You could start with just one individual to test things out, and run the baroni/madagascariensis primer sets in different tubes to avoid potential complications. And then as long as you only really get an amplicon of the expected size, you should be good.

OH and I guess the other thing you'd need is some sort of kit for amplifying genomic DNA from swabs or other similar method.

But yeah, this would be a nice thing for us to have in the hobby, to confirm/prove the identities of baroni/madagascariensis. Other methods are completely subjective...
Already had some sterile swabs available, so I swabbed their skin yesterday and extracted DNA from it (we had a few spare DNA extraction kits from free testers). I'll try and measure DNA content of the extracts and do a PCR test with general eukaryotic primers to see if the extractions worked. Hopefully most will work because I'd prefer to not have to swab them again, it's not exactly pleasant for them.

I'll try to get a hold of one of the primer pairs for each species. I've selected pairs which have different amplicon size for each species (618 bp for mad and 1028 bp for baroni), GC clamps and relatively low self-compatibility so hopefully they work. Won't able to get and test them before the end of the week, but I'll keep you posted when I get any results.
 
  • Like
Reactions: Tijl

·
Registered
Joined
·
1,173 Posts
Best of luck with the samples Johan!
 
  • Like
Reactions: Johanovich

·
Registered
Joined
·
403 Posts
My guess is they are all Mantella baroni, especially after listening to the captive-bred one call in the video (it is a single one note metalic dink, not a two note chirp like you would expect for madagascariensis). Mantella baroni are really variable, not all will have a single dot on their chin, although I agree it is kind of unusual to have a group with so many characteristics which seem to be in-between. That said, you really won't know with certainty what species they are unless you know where the wild ones were collected or go ahead and do the genetic work.

I also think it is interesting the captive-bred ones have such unusual coloration. This can be an issue for other captive frogs too, including other mantellas. For example, how many captive-bred aurantiaca do you see with red flashmarks? Often they are missing or washed out and yellow. Often captive-bred mantellas are faded and less intensely colored than their wild counterparts. Maybe it relates to diet of breeders, tadpoles, or juveniles as they grow. In this case, it is almost as if they captive-bred baroni are not losing their juvenile coloration even though they are now adults.
 

·
Registered
Joined
·
155 Posts
Discussion Starter #28
My guess is they are all Mantella baroni, especially after listening to the captive-bred one call in the video (it is a single one note metalic dink, not a two note chirp like you would expect for madagascariensis). Mantella baroni are really variable, not all will have a single dot on their chin, although I agree it is kind of unusual to have a group with so many characteristics which seem to be in-between. That said, you really won't know with certainty what species they are unless you know where the wild ones were collected or go ahead and do the genetic work.

I also think it is interesting the captive-bred ones have such unusual coloration. This can be an issue for other captive frogs too, including other mantellas. For example, how many captive-bred aurantiaca do you see with red flashmarks? Often they are missing or washed out and yellow. Often captive-bred mantellas are faded and less intensely colored than their wild counterparts. Maybe it relates to diet of breeders, tadpoles, or juveniles as they grow. In this case, it is almost as if they captive-bred baroni are not losing their juvenile coloration even though they are now adults.
They are actually still losing their juvenile coloration, they're just taking very long to do so. This picture was snapped last week of the CB individual nr 2. The back is almost black now (there is some light reflecting off of it on the picture) and the blueish green on the flanks is slowly becoming more green. Still I doubt they will get the exact same colors as the WC adults.

 

·
Registered
Joined
·
2,469 Posts
They are actually still losing their juvenile coloration, they're just taking very long to do so. This picture was snapped last week of the CB individual nr 2. The back is almost black now (there is some light reflecting off of it on the picture) and the blueish green on the flanks is slowly becoming more green. Still I doubt they will get the exact same colors as the WC adults.

Yeah, a lot of the mantella are more brown-ish until they're adults. If I recall correctly, the single baroni offspring that Josh's was selling was pretty brown also.
 

·
Registered
Joined
·
155 Posts
Discussion Starter #30
First set of primers had no amplification for either species, too bad but I've got one more set for madagascariensis and two more for baroni.

Will try again next week with the next set for both.
 

·
Registered
Joined
·
155 Posts
Discussion Starter #31
So here are the first results of the genetic tests.

First of all, to clarify who is who:
WC1 (male)


WC2 (female)


WC3 (male)


CB1 (male)


CB2 (unknown)


CB3 (unknown)


Then for the DNA concentration of the extracts:
WC1: 16.5 ng/ul. I extracted DNA from tissue when this one died so it is logical this is very high
WC2: 10.0 ng/ul I managed to get a swab from this one while she was shedding, so again a good DNA yield.
WC3: 0.14 ng/ul
CB1: 0.0904 ng/ul
CB2: 0.224 ng/ul
CB3 0.0404 ng/ul

The other ones are much lower, and there is no guarantee that what I measured is Mantella DNA. Their skin has microbes on it and any soil that clings to the swab also gets DNA extracted. That being said, if there is Mantella DNA in it, a PCR doesn't need much to get going.

Here is the picture of the gel of the first test with baroni and madagascariensis primers:

No amplification anywhere except for WC2 with the madagascariensis primers, but the sizes and multiple lines suggests it is mostly nonspecific product. Just compare the product with the ladders on both sides.

So I redid the test with the next sets of primers, two sets of baroni and one madagascariensis set:

I've blacked out some results for another unrelated lab test on the left for clarity. Again, nearly all failed for the madagascariensis primer set, except WC1 but again there is a lot of nonspecific product similar to what I saw in the first test. One of the lines is close to the expected size of 669, but the other line is way too big. Looking at the set of baroni primers it is clear that all WC individuals have positive product, although the sizes are a bit off in half of them. There is also some product for CB2, but the size is also too large (expected 387 bp long).

Because of these conflicting results I decided to do another test, this time with both baroni primers that gave product (leaving out the one that completely failed the first test) and both madagascariensis sets. I also did it in duplicate to hopefully get a bit better robustness in the results.

Again all WC individuals clearly give product for both baroni primers, and this time only the size for WC3 is a bit off. CB2 also has product, but much less compared to the WC ones and also too large (expected 387 bp). Looking at the madagascariensis primers it is clearly a mess. The left block should give product of 618 bp long and the right should give product of 669 bp if positive, and it is clear that there is a lot of nonspecific product being generated. On the left you can see that WC1 and WC2 make product of 1500bp, CB1, CB2 and CB3 give product between 800 bp and 900 bp long. On the right WC1, CB1, CB2 and CB3 again make product between 800 and 900bp long, and WC2 makes product of roughly 600bp long.

So what can we conclude from this?

-Clearly the extractions worked for all WC individuals and probably also for CB2, although this last one seems to have a much lower starting point judging from the PCR products. I can't say for sure whether CB1 and CB3 have sufficient Mantella DNA in the extracts, as they don't seem to give good PCR results. There is DNA in their extracts, but it might just as well be mostly bacterial and other stuff that just creates nonspecific product. It seems that to get a good yield consistently, it is best to either have actual tissue or get lucky and catch them while shedding when doing swabs.

-The first baroni primer did not work, but the two other baroni primers give consistent and (what looks like) specific products, although maybe there is some size variation but this could also be due to the gel not running at the same speed throughout. So far it seems to suggest that all WC individuals are at the very least partially baroni, and the same might be true for CB2.

-The madagascariensis primers are a mess, there is nonspecific product throughout, and it is not consistent for individuals between runs. This makes it very difficult to get clear conclusions. However the main problem is that I do not have a madagascariensis positive control to compare results with.

Which brings me to my final point: a friend of mine from Germany (Philipp Beines) has been kind enough to provide me with these much needed madagascariensis controls. He is going to send me some tadpoles (stored in ethanol) of what you could call the quintessential madagascariensis. Here are a few pictures of some of his offspring, showing the typical red throughout the thighs, horseshoe/trident markings on the throat and flashmarks on the legs:


He will also send a few more skin swabs of baroni and nigricans to test whether the primers work for these animals as well. It will be interesting to see if the madagascariensis and nigricans give product from the baroni primers, and if the madagascariensis give clear specific product for the primers meant for them.

So sadly, no complete conclusive answer yet. I'll post the next results in a week or two.
 

·
Registered
Joined
·
2,469 Posts
First of all, hats off to you, for your commitment to the craft!

OK also, I've done some cutting edge image processing to reorganize your gel into a format I personally like better lol. Here are the results again, for expt2:

BARONI

ADULTS:
  • WC1 and WC2 seem to be at the expected size for both primer sets. Small secondary products are visible at ~1500.
  • WC3 seems to be at an unexpected size -- consistently ~100-200bp bigger than the other WC
OFFSPRING:
  • CB1 and CB3 had no amplification
  • CB2's amplicon is at an unexpected size, ~200-300bp bigger than the expected
CONCLUSIONS:
Assuming the published data is reliable, WC1 and WC2 have Baroni DNA in them. It's possible that CB1 and CB3 had no amplification because either there was no frog DNA collected, or because they have no Baroni DNA. WC3 and CB2 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.


MADAGASCARIENSIS

ADULTS:
  • WC1 has a smear for both sets.
  • WC2 has a smear for one set. The other set has an amplicon at the expected size, with secondary products.
  • WC3 looks like there is no amplification
OFFSPRING:
  • CB1, CB2, and CB3 yielded fairly clean products; these products are not at the expected sizes
CONCLUSIONS:
The smearing might be caused by sub-optimal primer sequences; they could also be caused by sub-optimal PCR conditions, such as wrong concentrations of enzyme, DNA, or primers. One of the primer sets indicates that WC2 has madagascariensis DNA. CB1, CB2, and CB3 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.



DISCUSSION:
The results of the experiment would conclude that WC1 and WC2 have Baroni DNA, and that WC2 has madagascariensis DNA. However, due to the general inconsistencies of the MADS PCR, it's hard to draw definitive conclusions from the MADS PCR. Some negative controls would be helpful here. It would be nice to have a negative-control PCR lane (without template DNA). It would also be nice to have a negative species, that should yield no amplification (e.g., a dendrobatid). Another possibility for the poor results of the MADS PCR is that we've put the wrong parameters into the primer design tool. I think new primers would deffinitely be helpful here.
Looking just at the BAR results, it looks like you have at least two different genotypes. Although it's hard to draw definitive conclusions from the data as a whole, the data would indicate that that you have a heterogeneous population on your hand, simply from the variety of results you got.

Adding a "known" madagascariensis would be a good control. Also worth noting with those frogs, looking at the provided picture, frogs can be seen with a large variation of chin markings, including no markings, and a single spot.
 

·
Registered
Joined
·
2,469 Posts
I did another primer BLAST for madagascariensis:
https://www.ncbi.nlm.nih.gov/tools/...2387&job_key=KzDVlU2f5Lvblt-Yvrbt5qWb3_e2hMLy
JOB ID: KzDVlU2f5Lvblt-Yvrbt5qWb3_e2hMLy

When I blasted many of the primer sequences, the resulting E-values weren't very promising, indicating the possibly for off-target binding.

Primer Pair #2 looked the most promising to me:
TCCAAATTGTCCGAGCCTCC
GTGATCCTAGCTGTCGTCGG
Product length 1017

Primer Pair #1 was my next choice:
TAGTCCTAGCGGGCACTCTT
GCATGCCATGGAATCGAACC
Product length 817

I BLAST-ed a few of the other results, and many of them showed cross-reactivity with baroni, or had similar scored with other organisms in the database.
 

·
Registered
Joined
·
155 Posts
Discussion Starter #34
First of all, hats off to you, for your commitment to the craft!

BARONI CONCLUSIONS:
Assuming the published data is reliable, WC1 and WC2 have Baroni DNA in them. It's possible that CB1 and CB3 had no amplification because either there was no frog DNA collected, or because they have no Baroni DNA. WC3 and CB2 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.

MADAGASCARIENSIS CONCLUSIONS:
The smearing might be caused by sub-optimal primer sequences; they could also be caused by sub-optimal PCR conditions, such as wrong concentrations of enzyme, DNA, or primers. One of the primer sets indicates that WC2 has madagascariensis DNA. CB1, CB2, and CB3 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.

DISCUSSION:
The results of the experiment would conclude that WC1 and WC2 have Baroni DNA, and that WC2 has madagascariensis DNA. However, due to the general inconsistencies of the MADS PCR, it's hard to draw definitive conclusions from the MADS PCR. Some negative controls would be helpful here. It would be nice to have a negative-control PCR lane (without template DNA). It would also be nice to have a negative species, that should yield no amplification (e.g., a dendrobatid). Another possibility for the poor results of the MADS PCR is that we've put the wrong parameters into the primer design tool. I think new primers would deffinitely be helpful here.
Looking just at the BAR results, it looks like you have at least two different genotypes. Although it's hard to draw definitive conclusions from the data as a whole, the data would indicate that that you have a heterogeneous population on your hand, simply from the variety of results you got.

Adding a "known" madagascariensis would be a good control. Also worth noting with those frogs, looking at the provided picture, frogs can be seen with a large variation of chin markings, including no markings, and a single spot.
Thanks, not sure where you see frogs without markings or a single spot in the photographs. I think this is mainly a play of light but if you look closely they all have horseshoe marks, most of them whole but I can see one that has an interrupted marking.

Anyhow, I did include negative controls with no template which were negative. I didn't have any non amplifying frog DNA, but that could be arranged (I've got auratus and afrixalus frogs that could provide this). Philipp is also including nigricans and betsileo swabs which would be interesting to include for nonspecific Mantella amplification. I think I'll get a few more primer pairs (including the ones you suggested for madagascariensis) and hope I'll get less non specific amplification. I'm not entirely happy with the amplification from all sets so far as there seems to be PCR to PCR variation (e.g. WC2 having different amplicon lengths and CB2 failing/not failing between PCRs and replicates)

Currently looking at these primers for baroni as they give good blast results against both the Mantella database and the general database. Interestingly, there appear to be two regions in the reference genome that are good for making specific products. One starts around 9072 bp in and the other starts at 8895 bp in, but this second region is slightly less specific.

TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707

TTCCATTGGTCACCTGGGCT
CCGGGGCTTCTCCCGTTTTA
Expected size: 746

CTCTGCTCCCAGGACTCATTT
TTTCTGCCGGGGCTTCTC
Expected size: 930

TCTGCTCCCAGGACTCATTTT
CGCTGGATAGAGTGTTTAGCTG
Expected size: 876

The second region (last two primer pairs) has a less good general blast hit, but it still seems decent enough to work.

I might try to get new DNA extracted from CB1 and CB3, but I'll only do this after I get the results with new primers and the animals from Philipp.
 
  • Like
Reactions: NaMa

·
Registered
Joined
·
2,469 Posts
TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707
  • On my end, BLASTing this primer gives 100% ident for both species for some reason

And again, I feel like the published data should been taken with a grain of salt. Like, I really think that maybe not enough individual frogs were sequenced to compensate for the variability within the population/species. Any idea how many individuals you'd need for this?
 

·
Registered
Joined
·
155 Posts
Discussion Starter #36
TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707
  • On my end, BLASTing this primer gives 100% ident for both species for some reason

And again, I feel like the published data should been taken with a grain of salt. Like, I really think that maybe not enough individual frogs were sequenced to compensate for the variability within the population/species. Any idea how many individuals you'd need for this?
Yes I'm aware of this. For some reason all the reverse primers I got had this problem with one exception, and even that one doesn't give great results in the BLAST with other Mantella species:
CCCGTTTTAAAGAGACGGGAGA

I'm currently trying to find a better alternative, but given that this was the only one out of a 100 returned options it's not looking great. Perhaps I'll have a look at some of the other forward primers which had ok results and see how their reverse complement performs in terms of primer compatibility and amplicon size when combined with one of the other forward primers.

I think it's impossible to determine how many individuals are necessary as long as we don't have any information on where the animals were collected. We would first need to determine if and how much variation occurs within a population before combining several populations.
 
  • Like
Reactions: NaMa

·
Registered
Joined
·
155 Posts
Discussion Starter #37
Using reverse complements of some the good forward primers, I found these combinations that should be relatively specific for both primers.

Pair 1
CTCTGCTCCCAGGACTCATTT
AGGTGGAAGACCTGCAAGTG
Expected size: 401bp

Pair 2
TCTTCCATTGGTCACCTGGG
TGAACAGGGCAAAAGAGGTGA
Expected size: 460bp

Pair 3
ACCCCTCTTCAACCAGTCTT
TGAACAGGGCAAAAGAGGTGA
Expected size: 729 (same reverse, different forward as previous pair)

Pair 4
CCTCCTTAACCCCTCTTCAACC
GCCCAGGTGACCAATGGAAG
Expected size: 298 (the reverse for this is almost exactly the reverse complement of the pair 2 forward)

I can't find any combinations to make long products (~1000bp) because of the suitable regions for specific primers being so close to each other. Longest I can make is by combining the forward of pair 4 with the reverse of pair 3 for a product of 736bp, but this hardly seems better than what I've already listed.
 
  • Like
Reactions: NaMa

·
Registered
Joined
·
155 Posts
Discussion Starter #38
So I finally got around to re-doing the analysis with the new primers.

Codes for my animals are the same as before, and for Philipp's animals I've added extracts from his baroni swab, three madagascariensis tadpoles (extracted from half the tail), a swab from nigricans and a swab from betsileo/ebenaui as outliers.

Extract concentrations

Baroni Philipp: 0.656 ng/ul
Mad1: 13.2 ng/ul
Mad2: 13.0 ng/ul
Mad3: 12.6 ng/ul
Nigricans: 1.14 ng/ul
Betsileo/ebenaui: 1.41 ng/ul

So at first sight the extractions seem to have worked well.

Here's the original gel picture from the electrophoresis. I've put 10 ul of PCR product on the gel, which is twice as much as I would normally do. PCR had 30 cycles so successful samples should contain a bucketload of DNA on the gel.



I've gone ahead and done the cutting edge image processing immediately to be able to directly compare results ;)



And my interpretation:
WC1: Faint band of correct mad size product and band of aspecific product in the same lane, but very thick bands for baroni products.
WC2: Same as WC1 for the first lane, and two aspecific products in lane 2. Also very thick baroni specific bands
WC3: Aspecific band in second lane, otherwise no amplification

CB1: No mad primer product, bands for baroni but appear to be bigger than expected.
CB2: Aspecific mad products, otherwise no amplification
CB3: Very faint aspecific mad product, otherwise no amplification

Baroni Philipp: Aspecific mad band, faint baroni specific products but also a faint aspecific baroni band.
Nigricans: Faint band of correct mad size product and also faint aspecific bands for both mad and bar primers. There are also faint bands of correct baroni size.
Betsileo/Ebenaui: Only faint aspecific products

Mad1: Specific mad products, smears for bar primers
Mad2: same as Mad1
Mad3: same as Mad1

Negative: all negative :D

So my conclusions from this:
Considering that nearly all non-madagascariensis animals that amplified some products gave the same size of product (slightly above 1000bp), this seems to be a likely candidate for aspecific product. Unfortunately this size is very close to the mad primer 1 target size, which makes it difficult to make hard conclusions

WC1 and WC2 clearly have almost exclusively baroni DNA in them. Even if the band for mad primer 1 is actual correct product, this pales in comparison to the baroni product.

WC3, CB2 and CB3 have mosltly failed amplification, although there was some aspecific product. I would probably have to repeat swabs, extractions and PCRs to maybe get better results.

Phillipp's swabs seem to have little frog DNA in it, which is unfortunately common with skin swabs. There appears to be a little bit of baroni in both his baroni and nigricans swabs, but not much and with these faint bands it is difficult to get solid conclusions.

Phillipp's madagascariensis tads gave massive amounts of product for their intended primers and sizes, and no real amplification for baroni targets. So they appear to be pure mad.
 
21 - 38 of 38 Posts
Top