Mantella baroni introgression? Very picture heavy! - Dendroboard
Dendroboard

Go Back   Dendroboard > Miscellaneous > Other Amphibians > Mantella
Register Blogs FAQ Calendar Mark Forums Read Advertise

Support Our Sponsors
No Threads to Display.

facebook

Like Tree22Likes
  • 2 Post By Johanovich
  • 1 Post By Johanovich
  • 1 Post By Rain_Frog
  • 3 Post By Rain_Frog
  • 1 Post By hypostatic
  • 2 Post By hypostatic
  • 1 Post By Johanovich
  • 1 Post By Johanovich
  • 1 Post By Tijl
  • 1 Post By Johanovich
  • 1 Post By Johanovich
  • 1 Post By Johanovich
  • 1 Post By hypostatic
  • 1 Post By Johanovich
  • 1 Post By Tijl
  • 1 Post By hypostatic
  • 2 Post By Johanovich

Reply
 
LinkBack Thread Tools Display Modes
  #1 (permalink)  
Old 09-18-2019, 01:15 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Mantella baroni introgression? Very picture heavy!

Hi everyone,

I've got a small group Mantella baroni, which currently consists of three captive bred individuals (out of water May 2018) and two wildcaught ones. I know for certain that one of the CB ones is a male, as well as one of the WC ones. I suspect that another CB is male and that the remaining two individuals are females. I had another WC male, but this one died earlier (from stress induced from treatment for subdermal mites).

I noticed in both the WC and CB ones that there are some inconsistencies regarding baroni characteristics. I've listed below the characteristics for baroni and madagascariensis, and have highlighted the key differences between them.

Mantella baroni:
-SVL 22-30 mm
-Head, dorsum, and flanks are solid black
-A yellowish rostral stripe is present, generally ending past the eye but not connecting to the flank blotches
-Front limbs are yellow to greenish, this colour extending as large flank blotches
-Hindlimbs are orange with irregular black stripes
-There are no flashmarks on the lower hindlimbs
-Ventral side is black and marked with yellow to greenish, rarely blue blotches
-Ventrally the orange color of the legs does not extend onto the femur
-Throat has one circular marking, but may be all black
-The iris is black

Mantella madagascariensis:
-SVL 20-27 mm
-Upper head surface, dorsum and flanks usually blackish
-Yellowish rostral stripe present, often in contact with flank blotch
-Front limbs are yellow to green, this colour extending as large flank blotches
-Hindlimbs orange, with or without blackish crossbands and marblings
-Distinct orange flashmarks present on lower hindlimbs (this often turns yellow in CB individuals)
-Ventral side is black with light markings (mostly whitish-blue, sometimes yellow to green). These being generally rather large, rounded, and situated posteriorly on the venter.
-Ventrally the orange color of the legs extends well into femur, sometimes with black and yellow markings
-Throat has distinct horseshoe marking, more extended in males
-Iris mostly containing light pigment in its upper part

I got the captive bred ones as youngsters from a reputable source in Europe, and I trust the seller when he says that the parents are 100% baroni. They were identified as such by several Mantella experts including himself. He also mentioned that their back will turn black in time, so I'm not too worried about that for now.

So now for the photographs:

CB individual 1 (confirmed male)







Characteristics which conflict with baroni:
-There is some orange spotting on the ventral side of the femur
-There is an interrupted horseshoe shape on the throat

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-There are no flashmarks on the legs
-The iris is all black

CB individual 2 (likely male)





Characteristics which conflict with baroni:
-There is orange spotting on the ventral side of the femur
-There is more than one spot on the throat

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-There are no flashmarks on the legs
-The iris is all black

CB individual 3 (potentially female)








Characteristics which conflict with baroni:
-There is a decent amount of orange spotting on the ventral side of the femur
-There is an interrupted horseshoe shape on the throat

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-There are no flashmarks on the legs
-The iris is all black

Deceased WC individual (confirmed male and in my opinion, sadly the most beautiful one I had)





Characteristics which conflict with baroni:
-The iris has a gold upper part

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-No orange on the ventral side of the femur
-There are no flashmarks on the legs
-There is a single spot on the throat

WC individual 2 (confirmed male)








Characteristics which conflict with baroni:
-The iris has a gold upper part

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-No orange on the ventral side of the femur
-There are no flashmarks on the legs
-There is a single spot on the throat

WC individual 3 (likely female)







Characteristics which conflict with baroni:
None

Characteristics congruent with baroni and speaking against madagascariensis:
-The rostral stripe does not connect to the flank blotches
-No orange on the ventral side of the femur
-There are no flashmarks on the legs
-There is a single spot on the throat
-The iris is solid black

So what are your opinions on this? Personally I suspect that there has been some introgression into some wildcaught baroni, and my main suspect would be Mantella nigricans as this species often has interrupted horseshoe markings on the throat and a gold upper part of the iris. Nigricans also does not have flashmarks and a recent study has shown that genetically the two species probably have intermixed in recent history (evolutionary speaking).
Ravage and Tijl like this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
The Following User Says Thank You to Johanovich For This Useful Post:
Tijl (09-18-2019)
Sponsored Links
Advertisement
 
  #2 (permalink)  
Old 09-18-2019, 02:35 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Also, does anyone here happen to have some of the CB baroni from Josh's frogs? I'd be most interested in how they grow up color and pattern wise.
Tijl likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #3 (permalink)  
Old 09-22-2019, 01:57 AM
Rain_Frog's Avatar
Senior Member
 
Join Date: Apr 2004
Location: Overland Park, KS
Posts: 3,936
Thanks: 46
Thanked 104 Times in 69 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

I would probably say the mint green frog with some speckling on its back that appears to be missing most of its flashmarks from top view on the femur could be a madagascariensis, even though the easiest way to differentiate the two visually is the orange flashmark on the femur. I used to have a frog that looked nearly identical except he had orange flash marks and red all the way on the underside of the legs up to the waist. If you got them from a reputable source it could just be variation. Unfortunately there is no locale data for any mantellas so there could be different morphs that people have mixed unintentionally.

However, the picture from Joshsfrogs of their CB baroni had the light mint green color as froglets, so it could just be an age thing.

I have not bred baroni, but from the images online of CB baroni vs CB mads, mads are mostly brown when they morph out and teeny tiny with almost no green coloration.

Note though there are arguments that madagascariensis may be a complex of species, but baroni is genetically identical to nigricans.
Johanovich likes this.

Last edited by Rain_Frog; 09-22-2019 at 02:14 AM.
Reply With Quote
The Following User Says Thank You to Rain_Frog For This Useful Post:
Johanovich (09-22-2019)
 
  #4 (permalink)  
Old 09-22-2019, 10:06 PM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

At least a few of your frogs appear to be madagascariensis

Quote:
Originally Posted by Johanovich View Post
Also, does anyone here happen to have some of the CB baroni from Josh's frogs? I'd be most interested in how they grow up color and pattern wise.
From what I understand, Josh's has only been able to breed a SINGLE individual to the froglet stage. Other than that, there is pretty much NO ONE being successful in breeding this species.
Reply With Quote
  #5 (permalink)  
Old 09-23-2019, 12:35 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Rain_Frog View Post
I would probably say the mint green frog with some speckling on its back that appears to be missing most of its flashmarks from top view on the femur could be a madagascariensis, even though the easiest way to differentiate the two visually is the orange flashmark on the femur. I used to have a frog that looked nearly identical except he had orange flash marks and red all the way on the underside of the legs up to the waist. If you got them from a reputable source it could just be variation. Unfortunately there is no locale data for any mantellas so there could be different morphs that people have mixed unintentionally.

However, the picture from Joshsfrogs of their CB baroni had the light mint green color as froglets, so it could just be an age thing.

I have not bred baroni, but from the images online of CB baroni vs CB mads, mads are mostly brown when they morph out and teeny tiny with almost no green coloration.

Note though there are arguments that madagascariensis may be a complex of species, but baroni is genetically identical to nigricans.
Thanks for the info, as I mentioned in my original post, I'd consider the seller to be a highly reputable source. I don't have photographs of the froglets when they just morphed out unfortunately as I only got them when they were already 9 months of age.

Earliest photograph I have (around 9 months OOW):



And a little under a month later:


I've done a bit of digging on the forum and there seem to be other threads documenting Mantella baroni with aberrant characteristics (horseshoe shaped spots on throats and gold upper part of iris). In particular these two are interesting with regard to the characteristics shown:
https://www.dendroboard.com/forum/id...at-specie.html
https://www.dendroboard.com/forum/me...ella-tank.html

I'll keep an eye on mine and post some more pictures now and then.

Quote:
Originally Posted by hypostatic View Post
At least a few of your frogs appear to be madagascariensis



From what I understand, Josh's has only been able to breed a SINGLE individual to the froglet stage. Other than that, there is pretty much NO ONE being successful in breeding this species.
I wasn't aware that this was only a single froglet. However I do know a few people in europe who at least have had clutches (both fertile and infertile) and tadpoles of baroni.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis

Last edited by Johanovich; 09-23-2019 at 12:37 PM.
Reply With Quote
  #6 (permalink)  
Old 09-23-2019, 05:20 PM
Tijl's Avatar
Member
 
Join Date: Feb 2019
Posts: 397
Thanks: 43
Thanked 54 Times in 44 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

i would just try and contact Josh for this? Also Serge Pasquasi has worked with mantella in Madagascar, I am sure he knows people that breed them. In Hamm, there is always a mantella breeder selling his offspring frogs. ( I think he is the breeder of your frogs? )

But I also sure, most mantella are just wild caught.
__________________
Bastimentos,Citronella,Azureus,Hahneli,Patricia,Te rribilis,Escudo,Tumucumaque,Histrionica Bullseye.
Reply With Quote
  #7 (permalink)  
Old 09-23-2019, 09:19 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Tijl View Post
i would just try and contact Josh for this? Also Serge Pasquasi has worked with mantella in Madagascar, I am sure he knows people that breed them. In Hamm, there is always a mantella breeder selling his offspring frogs. ( I think he is the breeder of your frogs? )

But I also sure, most mantella are just wild caught.
Already did in June, got this reponse from them:


"Cara (Josh's Frogs HelpDesk)

Jun 18, 10:59 AM EDT

Thanks for reaching out to us! At this time, Josh's Frogs does not offer pictures of individual frogs for sale. Here's why:

Additional Stress to the animals
We produce and ship out a LOT of frogs. The additional handling of each froglet for pictures would cause extra, unnecessary stress for every animal that leaves our doors. Stress can cause a reduction in appetite and slow down in growth - we want our froglets to be the biggest possible for their age!

Time
It takes a LOT of time to take care of, breed, and clean up after thousands of frogs, and it would take even more time to get individual pictures of each animal. We feel that our time is best spent ensuring every animal purchased from Josh's Frogs is happy, healthy, and the best it can be.

Biosecurity
We maintain strict biosecurity and quarantine protocols at Josh's Frogs. These do not allow for froglets to leave the raising rooms for pictures, then return to them. We must adhere to these principles for the safety of our animals.

Reserving Frogs
We do not hold specific frogs for customers. Instead, we ship out the largest frogs we have on hand when an order ships. That way, we can ensure our customers are receiving the largest, well started froglets possible when they receive their order.

Froglet Variability
Many species of frogs (especially some dart frogs) are quite variable. We've put together many pictures of each morph on their specific product page to provide you with a better idea of what your froglets could look like.


Thank you for choosing Josh's Frogs! Have a great day!
-Cara"

So sadly no extra pics of their froglet(s)

The Mantella breeder in Hamm is someone I know (and he is not the source of my frogs). He has a breeding group of baroni but so far he only had infertile clutches. He does breed M. madagascariensis (and other Mantella species). I'll shoot a message to Serge to see if he has more info.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #8 (permalink)  
Old 09-23-2019, 10:17 PM
Tijl's Avatar
Member
 
Join Date: Feb 2019
Posts: 397
Thanks: 43
Thanked 54 Times in 44 Posts
Default

Understory enterprises also claim to sell only captivebred mantella, mayebe they are worth a try?

Ive been in touch with them in past and they helped me out allot back then.
__________________
Bastimentos,Citronella,Azureus,Hahneli,Patricia,Te rribilis,Escudo,Tumucumaque,Histrionica Bullseye.
Reply With Quote
  #9 (permalink)  
Old 09-23-2019, 10:36 PM
Rain_Frog's Avatar
Senior Member
 
Join Date: Apr 2004
Location: Overland Park, KS
Posts: 3,936
Thanks: 46
Thanked 104 Times in 69 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Baroni / cowani / nigricans are difficult frogs to breed, but some people like Joshsfrogs have gotten them to breed. I talked to Joshsfrogs a while back and they said they got baroni to breed and what they did was keep them in very, very large groups. They were for sale for a while and the froglets pictured had uniform light mint green with brownish gray backs like in the picture. The froglet pictures are still up under " baroni" on their website. I'm pretty sure it's diet related why most of us have poor success, which is a shame because baroni are so commonly imported yet few people have gotten them figured out. I can say at least visually those froglets have to be baroni or baroni / mad crosses.
hypostatic, Johanovich and Tijl like this.
Reply With Quote
  #10 (permalink)  
Old 09-24-2019, 02:31 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Here's a quick assessment of the adults (it's kinda hard on my computer cuz the images aren't resizing properly, and the images are huuuuuge)

WC individual 3 (likely female)
baroni

Deceased WC individual
madagasc
orange flashmarks

WC individual 2 (confirmed male)
madagasc
light upper iris


Quote:
Originally Posted by Rain_Frog View Post
I can say at least visually those froglets have to be baroni or baroni / mad crosses.
I would agree here. Their chins have almost the classic madagascariensis "U", I can't see them NOT having any madagasc in them.
Tijl likes this.
Reply With Quote
  #11 (permalink)  
Old 09-24-2019, 02:44 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Also, another way to figure it out is with the calls. Madagac is usually *chirp*chirp* or *chirpy*chirp*. Baroni is *tick*..*tick*..*tick*.

Madagascariensis calling:

Baroni calling:
https://amphibiaweb.org/sounds/Mantella_baroni.mp3

*also just noticed the eyes in Deceased WC individual. This would also support madagasc
Johanovich and Tijl like this.
Reply With Quote
The Following User Says Thank You to hypostatic For This Useful Post:
Johanovich (09-24-2019)
  #12 (permalink)  
Old 09-24-2019, 09:18 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Rain_Frog View Post
Baroni / cowani / nigricans are difficult frogs to breed, but some people like Joshsfrogs have gotten them to breed. I talked to Joshsfrogs a while back and they said they got baroni to breed and what they did was keep them in very, very large groups. They were for sale for a while and the froglets pictured had uniform light mint green with brownish gray backs like in the picture. The froglet pictures are still up under " baroni" on their website. I'm pretty sure it's diet related why most of us have poor success, which is a shame because baroni are so commonly imported yet few people have gotten them figured out. I can say at least visually those froglets have to be baroni or baroni / mad crosses.
Yeah I noticed those photographs on their website. It's a shame there are no ventral photographs of that froglet.

Quote:
Originally Posted by hypostatic View Post
Here's a quick assessment of the adults (it's kinda hard on my computer cuz the images aren't resizing properly, and the images are huuuuuge)

WC individual 3 (likely female)
baroni

Deceased WC individual
madagasc
orange flashmarks

WC individual 2 (confirmed male)
madagasc
light upper iris




I would agree here. Their chins have almost the classic madagascariensis "U", I can't see them NOT having any madagasc in them.
Sorry about the massive size of the photographs. I don't see the flashmarks you're referring to though, I'll see if I can make a clear photograph of the legs of the WC male (and post it a bit smaller).

Quote:
Originally Posted by hypostatic View Post
Also, another way to figure it out is with the calls. Madagac is usually *chirp*chirp* or *chirpy*chirp*. Baroni is *tick*..*tick*..*tick*.

Madagascariensis calling:
https://www.youtube.com/watch?v=HAEIRauZ7KA

Baroni calling:
https://amphibiaweb.org/sounds/Mantella_baroni.mp3

*also just noticed the eyes in Deceased WC individual. This would also support madagasc
This is the CB male calling at the height of the calling bout (he usually starts slower and speeds up when he sees another frog). To me this sounds more like baroni, just a bit faster than the URL you posted:


I don't have videos of the other males calling (specifically because the WC one only calls sporadically) but they also have singular "ticks" when they call.
Tijl likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis

Last edited by Johanovich; 09-24-2019 at 09:21 AM.
Reply With Quote
  #13 (permalink)  
Old 09-24-2019, 09:26 AM
Tijl's Avatar
Member
 
Join Date: Feb 2019
Posts: 397
Thanks: 43
Thanked 54 Times in 44 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Try using imgbb to upload your pictures Johan. We have the same "problem" at gifkikkerforum.be
__________________
Bastimentos,Citronella,Azureus,Hahneli,Patricia,Te rribilis,Escudo,Tumucumaque,Histrionica Bullseye.
Reply With Quote
  #14 (permalink)  
Old 09-24-2019, 10:01 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Tijl View Post
Try using imgbb to upload your pictures Johan. We have the same "problem" at gifkikkerforum.be
These were all uploaded with imgbb
Tijl likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #15 (permalink)  
Old 09-24-2019, 10:04 AM
Tijl's Avatar
Member
 
Join Date: Feb 2019
Posts: 397
Thanks: 43
Thanked 54 Times in 44 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post
These were all uploaded with imgbb
lol, missed this. thought i read tinypic a while aggo
Johanovich likes this.
__________________
Bastimentos,Citronella,Azureus,Hahneli,Patricia,Te rribilis,Escudo,Tumucumaque,Histrionica Bullseye.
Reply With Quote
  #16 (permalink)  
Old 09-27-2019, 12:34 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

The "flashmarks" are just splotches of slightly lighter orange. They are... pretty subjective lol. You can kinda see them here:



But besides that, the eyes are a fair giveaway:



if you compare to the female baroni, you can see how her eyes don't have the yellow accent, and how her legs are a much more even orange
Reply With Quote
  #17 (permalink)  
Old 09-30-2019, 02:59 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
The "flashmarks" are just splotches of slightly lighter orange. They are... pretty subjective lol. You can kinda see them here:



But besides that, the eyes are a fair giveaway:


if you compare to the female baroni, you can see how her eyes don't have the yellow accent, and how her legs are a much more even orange
I see what you mean, but I was always under the impression that Mantella flashmarks were located only within the joint between the femur and thigh, such as in this photograph of M. pulchra (picked from the internet):
Mantella pulchra.

I can't compare the deceased animal with the other two wildcaught individuals because I have a limited amount of photographs, but I'll see if I can make a picture of the remaining WC ones to compare their legs. Would be interesting to see if there is similar "splotching" going on in the other WC male with gold in the iris.

This identification guide is often given as a good reference: Correctly Identifying Mantella baroni and Mantella madagascariensis

The text on this guide states:
"Individual frogs sometimes exhibit ventral patterns that lie somewhere in between the two species." as well as "No one feature should be used as the only means of identification, as few individual frogs of either species exhibit all of the traits below. Instead, all information should be compared to that of an individual frog and whichever side matches the frog best is likely the species". This doesn't really help clearing the matter unfortunately

Given the presence of hybrids of several mantella species (e.g. baroni x cowani and madagascariensis x aurantiaca), maybe baroni and madagascariensis have some of each other's genes (and maybe others as well) mixed in anyway in certain populations? Only way to know for certain would be to do a genetic analysis I suppose. Too bad my PhD focuses on soil microbial communities with DNA techniques, I would've loved to work on frog phylogeny or population genetics.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #18 (permalink)  
Old 10-01-2019, 04:05 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Took a few shots of the two wildcaught individuals yesterday. As you can see, the legs of the female (bottom frog in both photographs) are not uniformly orange and also show kind of spots of lighter color.


Tijl likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #19 (permalink)  
Old 10-04-2019, 12:27 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post

The text on this guide states:
"Individual frogs sometimes exhibit ventral patterns that lie somewhere in between the two species." as well as "No one feature should be used as the only means of identification, as few individual frogs of either species exhibit all of the traits below. Instead, all information should be compared to that of an individual frog and whichever side matches the frog best is likely the species". This doesn't really help clearing the matter unfortunately

Given the presence of hybrids of several mantella species (e.g. baroni x cowani and madagascariensis x aurantiaca), maybe baroni and madagascariensis have some of each other's genes (and maybe others as well) mixed in anyway in certain populations? Only way to know for certain would be to do a genetic analysis I suppose. Too bad my PhD focuses on soil microbial communities with DNA techniques, I would've loved to work on frog phylogeny or population genetics.
Yeah, the "flashmarks" is pretty subjective in my opinion. I haven't seen enough/good evidence on what it actually means lol. Even the mantella guide just shows a drawing -- no example individuals.

That said, the U-chin is a classical madagascariensis trait that isn't found in baroni. I'd say the fact that the offspring have it, is pretty indicative that they have at least some madagascariensis lineage.

There definitely are documented naturally occurring hybrid individuals.

There isn't a published genome for madagascariensis and baroni, right? If you have access to a PCR machine, this would actually be a pretty easy/cheap thing to validate in the lab lol.
Reply With Quote
  #20 (permalink)  
Old 10-04-2019, 12:28 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post
Took a few shots of the two wildcaught individuals yesterday. As you can see, the legs of the female (bottom frog in both photographs) are not uniformly orange and also show kind of spots of lighter color.


what do the undersides and irises look like?
Reply With Quote
  #21 (permalink)  
Old 10-04-2019, 11:08 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
Yeah, the "flashmarks" is pretty subjective in my opinion. I haven't seen enough/good evidence on what it actually means lol. Even the mantella guide just shows a drawing -- no example individuals.

That said, the U-chin is a classical madagascariensis trait that isn't found in baroni. I'd say the fact that the offspring have it, is pretty indicative that they have at least some madagascariensis lineage.

There definitely are documented naturally occurring hybrid individuals.

There isn't a published genome for madagascariensis and baroni, right? If you have access to a PCR machine, this would actually be a pretty easy/cheap thing to validate in the lab lol.
I think you're gravely underestimating the ease and costs of DNA sequencing. Having a PCR machine in the lab (which we obviously do) does not help for sequencing on its own, you need a separate machine for that. There's also no need to sequence the whole genome, this is unnecessary as we can use some specific genes for species identification. Published data is available for these genes, so that would greatly help identification.

Quote:
Originally Posted by hypostatic View Post
what do the undersides and irises look like?
These are two animals that were already picture in the opening post, but here is the previous shot with the belly and eye shots together:
hypostatic likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #22 (permalink)  
Old 10-05-2019, 05:30 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post
I think you're gravely underestimating the ease and costs of DNA sequencing. Having a PCR machine in the lab (which we obviously do) does not help for sequencing on its own, you need a separate machine for that. There's also no need to sequence the whole genome, this is unnecessary as we can use some specific genes for species identification. Published data is available for these genes, so that would greatly help identification.
Well that's why I asked about whether reference genomes were available for the species. If they're published, you just need primers for stretches of DNA that are different for each species, and you can just do a regular genotyping PCR run. Sequencing wouldn't be necessary.

OH HEY, while the whole genome hasn't been published, it does look like there is some mtDNA data available:
https://www.ncbi.nlm.nih.gov/bioproject/?term=mantella

Here are specific primers based on that information:
Baroni
Madagascariensis

So yeah... you should be able to tell the species based on whether you get amplification or not, and by PCR band size...

Assuming you have access to everything else needed to run a PCR, the primers would only set you back about $40....
Reply With Quote
The Following User Says Thank You to hypostatic For This Useful Post:
Johanovich (10-05-2019)
  #23 (permalink)  
Old 10-05-2019, 10:03 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
Well that's why I asked about whether reference genomes were available for the species. If they're published, you just need primers for stretches of DNA that are different for each species, and you can just do a regular genotyping PCR run. Sequencing wouldn't be necessary.

OH HEY, while the whole genome hasn't been published, it does look like there is some mtDNA data available:
https://www.ncbi.nlm.nih.gov/bioproject/?term=mantella

Here are specific primers based on that information:
Baroni
Madagascariensis

So yeah... you should be able to tell the species based on whether you get amplification or not, and by PCR band size...

Assuming you have access to everything else needed to run a PCR, the primers would only set you back about $40....
I honestly hadn't considered that

I've worked with COI barcoding in the past and I'm now mostly doing metagenomics so this option completely slipped my mind.

I'll see if I can get this done somewhere in the next weeks, it might require some tweaking with cycle nr etc. and ideally I'll want a positive control for madagascariensis (but that's likely going to be difficult to get).
hypostatic likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #24 (permalink)  
Old 10-05-2019, 09:34 PM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post
I'll see if I can get this done somewhere in the next weeks, it might require some tweaking with cycle nr etc. and ideally I'll want a positive control for madagascariensis (but that's likely going to be difficult to get).
haha, yeah, there's still lots of old school genetics that gets done

The only real drawback for this approach is the fidelity of the available information. The paper is behind a paywall for me, so I'm not sure how rigorous their data collection methodology is. That said, the BLAST algorithm should prevent non species-specific primer binding. The primer design past is based on Primer3, which is also pretty accurate and trusted.

In this case a real positive control would be hard to get ahold of, due to the lack of information. But a well-designed assay would go a long way. You could start with just one individual to test things out, and run the baroni/madagascariensis primer sets in different tubes to avoid potential complications. And then as long as you only really get an amplicon of the expected size, you should be good.

OH and I guess the other thing you'd need is some sort of kit for amplifying genomic DNA from swabs or other similar method.

But yeah, this would be a nice thing for us to have in the hobby, to confirm/prove the identities of baroni/madagascariensis. Other methods are completely subjective...
Johanovich likes this.
Reply With Quote
  #25 (permalink)  
Old 10-08-2019, 09:53 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
haha, yeah, there's still lots of old school genetics that gets done

The only real drawback for this approach is the fidelity of the available information. The paper is behind a paywall for me, so I'm not sure how rigorous their data collection methodology is. That said, the BLAST algorithm should prevent non species-specific primer binding. The primer design past is based on Primer3, which is also pretty accurate and trusted.

In this case a real positive control would be hard to get ahold of, due to the lack of information. But a well-designed assay would go a long way. You could start with just one individual to test things out, and run the baroni/madagascariensis primer sets in different tubes to avoid potential complications. And then as long as you only really get an amplicon of the expected size, you should be good.

OH and I guess the other thing you'd need is some sort of kit for amplifying genomic DNA from swabs or other similar method.

But yeah, this would be a nice thing for us to have in the hobby, to confirm/prove the identities of baroni/madagascariensis. Other methods are completely subjective...
Already had some sterile swabs available, so I swabbed their skin yesterday and extracted DNA from it (we had a few spare DNA extraction kits from free testers). I'll try and measure DNA content of the extracts and do a PCR test with general eukaryotic primers to see if the extractions worked. Hopefully most will work because I'd prefer to not have to swab them again, it's not exactly pleasant for them.

I'll try to get a hold of one of the primer pairs for each species. I've selected pairs which have different amplicon size for each species (618 bp for mad and 1028 bp for baroni), GC clamps and relatively low self-compatibility so hopefully they work. Won't able to get and test them before the end of the week, but I'll keep you posted when I get any results.
Tijl likes this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #26 (permalink)  
Old 10-08-2019, 01:11 PM
Tijl's Avatar
Member
 
Join Date: Feb 2019
Posts: 397
Thanks: 43
Thanked 54 Times in 44 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Best of luck with the samples Johan!
Johanovich likes this.
__________________
Bastimentos,Citronella,Azureus,Hahneli,Patricia,Te rribilis,Escudo,Tumucumaque,Histrionica Bullseye.
Reply With Quote
  #27 (permalink)  
Old 10-09-2019, 03:53 PM
Devin Edmonds's Avatar
Member
 
Join Date: Mar 2004
Location: Illinois
Posts: 403
Thanks: 0
Thanked 50 Times in 8 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

My guess is they are all Mantella baroni, especially after listening to the captive-bred one call in the video (it is a single one note metalic dink, not a two note chirp like you would expect for madagascariensis). Mantella baroni are really variable, not all will have a single dot on their chin, although I agree it is kind of unusual to have a group with so many characteristics which seem to be in-between. That said, you really won't know with certainty what species they are unless you know where the wild ones were collected or go ahead and do the genetic work.

I also think it is interesting the captive-bred ones have such unusual coloration. This can be an issue for other captive frogs too, including other mantellas. For example, how many captive-bred aurantiaca do you see with red flashmarks? Often they are missing or washed out and yellow. Often captive-bred mantellas are faded and less intensely colored than their wild counterparts. Maybe it relates to diet of breeders, tadpoles, or juveniles as they grow. In this case, it is almost as if they captive-bred baroni are not losing their juvenile coloration even though they are now adults.
__________________
Devin Edmonds
[email protected]
http://www.amphibiancare.com
Reply With Quote
The Following User Says Thank You to Devin Edmonds For This Useful Post:
Johanovich (10-09-2019)
  #28 (permalink)  
Old 10-09-2019, 09:25 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Devin Edmonds View Post
My guess is they are all Mantella baroni, especially after listening to the captive-bred one call in the video (it is a single one note metalic dink, not a two note chirp like you would expect for madagascariensis). Mantella baroni are really variable, not all will have a single dot on their chin, although I agree it is kind of unusual to have a group with so many characteristics which seem to be in-between. That said, you really won't know with certainty what species they are unless you know where the wild ones were collected or go ahead and do the genetic work.

I also think it is interesting the captive-bred ones have such unusual coloration. This can be an issue for other captive frogs too, including other mantellas. For example, how many captive-bred aurantiaca do you see with red flashmarks? Often they are missing or washed out and yellow. Often captive-bred mantellas are faded and less intensely colored than their wild counterparts. Maybe it relates to diet of breeders, tadpoles, or juveniles as they grow. In this case, it is almost as if they captive-bred baroni are not losing their juvenile coloration even though they are now adults.
They are actually still losing their juvenile coloration, they're just taking very long to do so. This picture was snapped last week of the CB individual nr 2. The back is almost black now (there is some light reflecting off of it on the picture) and the blueish green on the flanks is slowly becoming more green. Still I doubt they will get the exact same colors as the WC adults.

__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #29 (permalink)  
Old 10-10-2019, 11:44 PM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by Johanovich View Post
They are actually still losing their juvenile coloration, they're just taking very long to do so. This picture was snapped last week of the CB individual nr 2. The back is almost black now (there is some light reflecting off of it on the picture) and the blueish green on the flanks is slowly becoming more green. Still I doubt they will get the exact same colors as the WC adults.

Yeah, a lot of the mantella are more brown-ish until they're adults. If I recall correctly, the single baroni offspring that Josh's was selling was pretty brown also.
Johanovich likes this.
Reply With Quote
  #30 (permalink)  
Old 10-11-2019, 05:48 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

First set of primers had no amplification for either species, too bad but I've got one more set for madagascariensis and two more for baroni.

Will try again next week with the next set for both.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #31 (permalink)  
Old 10-26-2019, 03:48 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

So here are the first results of the genetic tests.

First of all, to clarify who is who:
WC1 (male)


WC2 (female)


WC3 (male)


CB1 (male)


CB2 (unknown)


CB3 (unknown)


Then for the DNA concentration of the extracts:
WC1: 16.5 ng/ul. I extracted DNA from tissue when this one died so it is logical this is very high
WC2: 10.0 ng/ul I managed to get a swab from this one while she was shedding, so again a good DNA yield.
WC3: 0.14 ng/ul
CB1: 0.0904 ng/ul
CB2: 0.224 ng/ul
CB3 0.0404 ng/ul

The other ones are much lower, and there is no guarantee that what I measured is Mantella DNA. Their skin has microbes on it and any soil that clings to the swab also gets DNA extracted. That being said, if there is Mantella DNA in it, a PCR doesn't need much to get going.

Here is the picture of the gel of the first test with baroni and madagascariensis primers:

No amplification anywhere except for WC2 with the madagascariensis primers, but the sizes and multiple lines suggests it is mostly nonspecific product. Just compare the product with the ladders on both sides.

So I redid the test with the next sets of primers, two sets of baroni and one madagascariensis set:

I've blacked out some results for another unrelated lab test on the left for clarity. Again, nearly all failed for the madagascariensis primer set, except WC1 but again there is a lot of nonspecific product similar to what I saw in the first test. One of the lines is close to the expected size of 669, but the other line is way too big. Looking at the set of baroni primers it is clear that all WC individuals have positive product, although the sizes are a bit off in half of them. There is also some product for CB2, but the size is also too large (expected 387 bp long).

Because of these conflicting results I decided to do another test, this time with both baroni primers that gave product (leaving out the one that completely failed the first test) and both madagascariensis sets. I also did it in duplicate to hopefully get a bit better robustness in the results.

Again all WC individuals clearly give product for both baroni primers, and this time only the size for WC3 is a bit off. CB2 also has product, but much less compared to the WC ones and also too large (expected 387 bp). Looking at the madagascariensis primers it is clearly a mess. The left block should give product of 618 bp long and the right should give product of 669 bp if positive, and it is clear that there is a lot of nonspecific product being generated. On the left you can see that WC1 and WC2 make product of 1500bp, CB1, CB2 and CB3 give product between 800 bp and 900 bp long. On the right WC1, CB1, CB2 and CB3 again make product between 800 and 900bp long, and WC2 makes product of roughly 600bp long.

So what can we conclude from this?

-Clearly the extractions worked for all WC individuals and probably also for CB2, although this last one seems to have a much lower starting point judging from the PCR products. I can't say for sure whether CB1 and CB3 have sufficient Mantella DNA in the extracts, as they don't seem to give good PCR results. There is DNA in their extracts, but it might just as well be mostly bacterial and other stuff that just creates nonspecific product. It seems that to get a good yield consistently, it is best to either have actual tissue or get lucky and catch them while shedding when doing swabs.

-The first baroni primer did not work, but the two other baroni primers give consistent and (what looks like) specific products, although maybe there is some size variation but this could also be due to the gel not running at the same speed throughout. So far it seems to suggest that all WC individuals are at the very least partially baroni, and the same might be true for CB2.

-The madagascariensis primers are a mess, there is nonspecific product throughout, and it is not consistent for individuals between runs. This makes it very difficult to get clear conclusions. However the main problem is that I do not have a madagascariensis positive control to compare results with.

Which brings me to my final point: a friend of mine from Germany (Philipp Beines) has been kind enough to provide me with these much needed madagascariensis controls. He is going to send me some tadpoles (stored in ethanol) of what you could call the quintessential madagascariensis. Here are a few pictures of some of his offspring, showing the typical red throughout the thighs, horseshoe/trident markings on the throat and flashmarks on the legs:


He will also send a few more skin swabs of baroni and nigricans to test whether the primers work for these animals as well. It will be interesting to see if the madagascariensis and nigricans give product from the baroni primers, and if the madagascariensis give clear specific product for the primers meant for them.

So sadly, no complete conclusive answer yet. I'll post the next results in a week or two.
hypostatic and Tijl like this.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
  #32 (permalink)  
Old 10-27-2019, 06:28 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

First of all, hats off to you, for your commitment to the craft!

OK also, I've done some cutting edge image processing to reorganize your gel into a format I personally like better lol. Here are the results again, for expt2:

BARONI

ADULTS:
  • WC1 and WC2 seem to be at the expected size for both primer sets. Small secondary products are visible at ~1500.
  • WC3 seems to be at an unexpected size -- consistently ~100-200bp bigger than the other WC
OFFSPRING:
  • CB1 and CB3 had no amplification
  • CB2's amplicon is at an unexpected size, ~200-300bp bigger than the expected
CONCLUSIONS:
Assuming the published data is reliable, WC1 and WC2 have Baroni DNA in them. It's possible that CB1 and CB3 had no amplification because either there was no frog DNA collected, or because they have no Baroni DNA. WC3 and CB2 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.


MADAGASCARIENSIS

ADULTS:
  • WC1 has a smear for both sets.
  • WC2 has a smear for one set. The other set has an amplicon at the expected size, with secondary products.
  • WC3 looks like there is no amplification
OFFSPRING:
  • CB1, CB2, and CB3 yielded fairly clean products; these products are not at the expected sizes
CONCLUSIONS:
The smearing might be caused by sub-optimal primer sequences; they could also be caused by sub-optimal PCR conditions, such as wrong concentrations of enzyme, DNA, or primers. One of the primer sets indicates that WC2 has madagascariensis DNA. CB1, CB2, and CB3 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.



DISCUSSION:
The results of the experiment would conclude that WC1 and WC2 have Baroni DNA, and that WC2 has madagascariensis DNA. However, due to the general inconsistencies of the MADS PCR, it's hard to draw definitive conclusions from the MADS PCR. Some negative controls would be helpful here. It would be nice to have a negative-control PCR lane (without template DNA). It would also be nice to have a negative species, that should yield no amplification (e.g., a dendrobatid). Another possibility for the poor results of the MADS PCR is that we've put the wrong parameters into the primer design tool. I think new primers would deffinitely be helpful here.
Looking just at the BAR results, it looks like you have at least two different genotypes. Although it's hard to draw definitive conclusions from the data as a whole, the data would indicate that that you have a heterogeneous population on your hand, simply from the variety of results you got.

Adding a "known" madagascariensis would be a good control. Also worth noting with those frogs, looking at the provided picture, frogs can be seen with a large variation of chin markings, including no markings, and a single spot.
Reply With Quote
  #33 (permalink)  
Old 10-27-2019, 06:49 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

I did another primer BLAST for madagascariensis:
https://www.ncbi.nlm.nih.gov/tools/p...bt5qWb3_e2hMLy
JOB ID: KzDVlU2f5Lvblt-Yvrbt5qWb3_e2hMLy

When I blasted many of the primer sequences, the resulting E-values weren't very promising, indicating the possibly for off-target binding.

Primer Pair #2 looked the most promising to me:
TCCAAATTGTCCGAGCCTCC
GTGATCCTAGCTGTCGTCGG
Product length 1017

Primer Pair #1 was my next choice:
TAGTCCTAGCGGGCACTCTT
GCATGCCATGGAATCGAACC
Product length 817

I BLAST-ed a few of the other results, and many of them showed cross-reactivity with baroni, or had similar scored with other organisms in the database.
Reply With Quote
The Following User Says Thank You to hypostatic For This Useful Post:
NaMa (11-07-2019)
  #34 (permalink)  
Old 10-30-2019, 12:01 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
First of all, hats off to you, for your commitment to the craft!

BARONI CONCLUSIONS:
Assuming the published data is reliable, WC1 and WC2 have Baroni DNA in them. It's possible that CB1 and CB3 had no amplification because either there was no frog DNA collected, or because they have no Baroni DNA. WC3 and CB2 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.

MADAGASCARIENSIS CONCLUSIONS:
The smearing might be caused by sub-optimal primer sequences; they could also be caused by sub-optimal PCR conditions, such as wrong concentrations of enzyme, DNA, or primers. One of the primer sets indicates that WC2 has madagascariensis DNA. CB1, CB2, and CB3 have amplicons at UNexpected sizes. This is most likely due to the primer sets amplifying something that is unexpected/unknown.

DISCUSSION:
The results of the experiment would conclude that WC1 and WC2 have Baroni DNA, and that WC2 has madagascariensis DNA. However, due to the general inconsistencies of the MADS PCR, it's hard to draw definitive conclusions from the MADS PCR. Some negative controls would be helpful here. It would be nice to have a negative-control PCR lane (without template DNA). It would also be nice to have a negative species, that should yield no amplification (e.g., a dendrobatid). Another possibility for the poor results of the MADS PCR is that we've put the wrong parameters into the primer design tool. I think new primers would deffinitely be helpful here.
Looking just at the BAR results, it looks like you have at least two different genotypes. Although it's hard to draw definitive conclusions from the data as a whole, the data would indicate that that you have a heterogeneous population on your hand, simply from the variety of results you got.

Adding a "known" madagascariensis would be a good control. Also worth noting with those frogs, looking at the provided picture, frogs can be seen with a large variation of chin markings, including no markings, and a single spot.
Thanks, not sure where you see frogs without markings or a single spot in the photographs. I think this is mainly a play of light but if you look closely they all have horseshoe marks, most of them whole but I can see one that has an interrupted marking.

Anyhow, I did include negative controls with no template which were negative. I didn't have any non amplifying frog DNA, but that could be arranged (I've got auratus and afrixalus frogs that could provide this). Philipp is also including nigricans and betsileo swabs which would be interesting to include for nonspecific Mantella amplification. I think I'll get a few more primer pairs (including the ones you suggested for madagascariensis) and hope I'll get less non specific amplification. I'm not entirely happy with the amplification from all sets so far as there seems to be PCR to PCR variation (e.g. WC2 having different amplicon lengths and CB2 failing/not failing between PCRs and replicates)

Currently looking at these primers for baroni as they give good blast results against both the Mantella database and the general database. Interestingly, there appear to be two regions in the reference genome that are good for making specific products. One starts around 9072 bp in and the other starts at 8895 bp in, but this second region is slightly less specific.

TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707

TTCCATTGGTCACCTGGGCT
CCGGGGCTTCTCCCGTTTTA
Expected size: 746

CTCTGCTCCCAGGACTCATTT
TTTCTGCCGGGGCTTCTC
Expected size: 930

TCTGCTCCCAGGACTCATTTT
CGCTGGATAGAGTGTTTAGCTG
Expected size: 876

The second region (last two primer pairs) has a less good general blast hit, but it still seems decent enough to work.

I might try to get new DNA extracted from CB1 and CB3, but I'll only do this after I get the results with new primers and the animals from Philipp.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
The Following User Says Thank You to Johanovich For This Useful Post:
NaMa (11-07-2019)
  #35 (permalink)  
Old 10-31-2019, 03:37 AM
hypostatic's Avatar
Senior Member
 
Join Date: Apr 2011
Location: NYC/NJ
Posts: 2,404
Thanks: 118
Thanked 219 Times in 194 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707
  • On my end, BLASTing this primer gives 100% ident for both species for some reason

And again, I feel like the published data should been taken with a grain of salt. Like, I really think that maybe not enough individual frogs were sequenced to compensate for the variability within the population/species. Any idea how many individuals you'd need for this?
Reply With Quote
The Following User Says Thank You to hypostatic For This Useful Post:
NaMa (11-07-2019)
  #36 (permalink)  
Old 10-31-2019, 09:52 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Quote:
Originally Posted by hypostatic View Post
TCTTCCATTGGTCACCTGGG
GAAGCTCGCTGGATAGAGTGT
Expected size: 707
  • On my end, BLASTing this primer gives 100% ident for both species for some reason

And again, I feel like the published data should been taken with a grain of salt. Like, I really think that maybe not enough individual frogs were sequenced to compensate for the variability within the population/species. Any idea how many individuals you'd need for this?
Yes I'm aware of this. For some reason all the reverse primers I got had this problem with one exception, and even that one doesn't give great results in the BLAST with other Mantella species:
CCCGTTTTAAAGAGACGGGAGA

I'm currently trying to find a better alternative, but given that this was the only one out of a 100 returned options it's not looking great. Perhaps I'll have a look at some of the other forward primers which had ok results and see how their reverse complement performs in terms of primer compatibility and amplicon size when combined with one of the other forward primers.

I think it's impossible to determine how many individuals are necessary as long as we don't have any information on where the animals were collected. We would first need to determine if and how much variation occurs within a population before combining several populations.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
The Following User Says Thank You to Johanovich For This Useful Post:
NaMa (11-07-2019)
  #37 (permalink)  
Old 10-31-2019, 10:55 AM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

Using reverse complements of some the good forward primers, I found these combinations that should be relatively specific for both primers.

Pair 1
CTCTGCTCCCAGGACTCATTT
AGGTGGAAGACCTGCAAGTG
Expected size: 401bp

Pair 2
TCTTCCATTGGTCACCTGGG
TGAACAGGGCAAAAGAGGTGA
Expected size: 460bp

Pair 3
ACCCCTCTTCAACCAGTCTT
TGAACAGGGCAAAAGAGGTGA
Expected size: 729 (same reverse, different forward as previous pair)

Pair 4
CCTCCTTAACCCCTCTTCAACC
GCCCAGGTGACCAATGGAAG
Expected size: 298 (the reverse for this is almost exactly the reverse complement of the pair 2 forward)

I can't find any combinations to make long products (~1000bp) because of the suitable regions for specific primers being so close to each other. Longest I can make is by combining the forward of pair 4 with the reverse of pair 3 for a product of 736bp, but this hardly seems better than what I've already listed.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
The Following User Says Thank You to Johanovich For This Useful Post:
NaMa (11-07-2019)
  #38 (permalink)  
Old 11-24-2019, 12:32 PM
Johanovich's Avatar
Junior Member
 
Join Date: Jan 2017
Location: Belgium
Posts: 71
Thanks: 5
Thanked 6 Times in 6 Posts
Default Re: Mantella baroni introgression? Very picture heavy!

So I finally got around to re-doing the analysis with the new primers.

Codes for my animals are the same as before, and for Philipp's animals I've added extracts from his baroni swab, three madagascariensis tadpoles (extracted from half the tail), a swab from nigricans and a swab from betsileo/ebenaui as outliers.

Extract concentrations

Baroni Philipp: 0.656 ng/ul
Mad1: 13.2 ng/ul
Mad2: 13.0 ng/ul
Mad3: 12.6 ng/ul
Nigricans: 1.14 ng/ul
Betsileo/ebenaui: 1.41 ng/ul

So at first sight the extractions seem to have worked well.

Here's the original gel picture from the electrophoresis. I've put 10 ul of PCR product on the gel, which is twice as much as I would normally do. PCR had 30 cycles so successful samples should contain a bucketload of DNA on the gel.



I've gone ahead and done the cutting edge image processing immediately to be able to directly compare results



And my interpretation:
WC1: Faint band of correct mad size product and band of aspecific product in the same lane, but very thick bands for baroni products.
WC2: Same as WC1 for the first lane, and two aspecific products in lane 2. Also very thick baroni specific bands
WC3: Aspecific band in second lane, otherwise no amplification

CB1: No mad primer product, bands for baroni but appear to be bigger than expected.
CB2: Aspecific mad products, otherwise no amplification
CB3: Very faint aspecific mad product, otherwise no amplification

Baroni Philipp: Aspecific mad band, faint baroni specific products but also a faint aspecific baroni band.
Nigricans: Faint band of correct mad size product and also faint aspecific bands for both mad and bar primers. There are also faint bands of correct baroni size.
Betsileo/Ebenaui: Only faint aspecific products

Mad1: Specific mad products, smears for bar primers
Mad2: same as Mad1
Mad3: same as Mad1

Negative: all negative

So my conclusions from this:
Considering that nearly all non-madagascariensis animals that amplified some products gave the same size of product (slightly above 1000bp), this seems to be a likely candidate for aspecific product. Unfortunately this size is very close to the mad primer 1 target size, which makes it difficult to make hard conclusions

WC1 and WC2 clearly have almost exclusively baroni DNA in them. Even if the band for mad primer 1 is actual correct product, this pales in comparison to the baroni product.

WC3, CB2 and CB3 have mosltly failed amplification, although there was some aspecific product. I would probably have to repeat swabs, extractions and PCRs to maybe get better results.

Phillipp's swabs seem to have little frog DNA in it, which is unfortunately common with skin swabs. There appears to be a little bit of baroni in both his baroni and nigricans swabs, but not much and with these faint bands it is difficult to get solid conclusions.

Phillipp's madagascariensis tads gave massive amounts of product for their intended primers and sizes, and no real amplification for baroni targets. So they appear to be pure mad.
__________________
Currently keeping Dendrobates auratus "panama special", Mantella baroni and Afrixalus dorsalis
Reply With Quote
Reply

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On


Powered by vBadvanced CMPS v3.2.3

All times are GMT. The time now is 09:20 AM.


Powered by vBulletin® Version 3.8.8
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Search Engine Optimization by vBSEO 3.6.0
vBulletin Security provided by vBSecurity v2.2.2 (Pro) - vBulletin Mods & Addons Copyright © 2019 DragonByte Technologies Ltd.